Merge remote-tracking branch 'refs/remotes/exercism/master'

exercises/binary-search-tree/src/test/java/BSTTest.java

@@ -94,7 +94,7 @@ public class BSTTest {
         List<Integer> treeData = Collections.unmodifiableList(
                 Arrays.asList(4, 2, 6, 1, 3, 7, 5)
         );
-        treeData.forEach(value -> sut.insert(value));
+        treeData.forEach(sut::insert);
 
         List<Integer> actual = sut.getAsLevelOrderList();
         assertEquals(expected, actual);
@@ -155,7 +155,7 @@ public class BSTTest {
         List<Integer> treeData = Collections.unmodifiableList(
                 Arrays.asList(4, 2, 1, 3, 6, 7, 5)
         );
-        treeData.forEach(value -> sut.insert(value));
+        treeData.forEach(sut::insert);
 
         List<Integer> actual = sut.getAsSortedList();
         assertEquals(expected, actual);

exercises/change/src/test/java/ChangeCalculatorTest.java

@@ -26,7 +26,7 @@ public final class ChangeCalculatorTest {
                 changeCalculator.computeMostEfficientChange(25));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testChangeThatMustBeGivenInMultipleCoins() {
         ChangeCalculator changeCalculator = new ChangeCalculator(asList(1, 5, 10, 25, 100));
@@ -36,7 +36,7 @@ public final class ChangeCalculatorTest {
                 changeCalculator.computeMostEfficientChange(15));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     // https://en.wikipedia.org/wiki/Change-making_problem#Greedy_method
     public void testLilliputianCurrencyForWhichGreedyAlgorithmFails() {
@@ -47,7 +47,7 @@ public final class ChangeCalculatorTest {
                 changeCalculator.computeMostEfficientChange(23));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     // https://en.wikipedia.org/wiki/Change-making_problem#Greedy_method
     public void testLowerElbonianCurrencyForWhichGreedyAlgorithmFails() {
@@ -58,7 +58,7 @@ public final class ChangeCalculatorTest {
                 changeCalculator.computeMostEfficientChange(63));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLargeAmountOfChange() {
         ChangeCalculator changeCalculator = new ChangeCalculator(asList(1, 2, 5, 10, 20, 50, 100));
@@ -68,7 +68,7 @@ public final class ChangeCalculatorTest {
                 changeCalculator.computeMostEfficientChange(999));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testZeroChange() {
         ChangeCalculator changeCalculator = new ChangeCalculator(asList(1, 5, 10, 21, 25));
@@ -78,7 +78,7 @@ public final class ChangeCalculatorTest {
                 changeCalculator.computeMostEfficientChange(0));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testChangeLessThanSmallestCoinInCurrencyCannotBeRepresented() {
         ChangeCalculator changeCalculator = new ChangeCalculator(asList(5, 10));
@@ -89,7 +89,7 @@ public final class ChangeCalculatorTest {
         changeCalculator.computeMostEfficientChange(3);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testChangeLargerThanAllCoinsInCurrencyThatCannotBeRepresented() {
         ChangeCalculator changeCalculator = new ChangeCalculator(asList(5, 10));
@@ -100,7 +100,7 @@ public final class ChangeCalculatorTest {
         changeCalculator.computeMostEfficientChange(94);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNegativeChangeIsRejected() {
         ChangeCalculator changeCalculator = new ChangeCalculator(asList(1, 2, 5));

exercises/clock/src/test/java/ClockAddTest.java

@@ -5,7 +5,7 @@ import static org.junit.Assert.assertEquals;
 
 public class ClockAddTest {
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void addMinutes() {
         Clock clock = new Clock(10, 0);
@@ -13,7 +13,7 @@ public class ClockAddTest {
         assertEquals("10:03", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void addNoMinutes() {
         Clock clock = new Clock(6, 41);
@@ -21,7 +21,7 @@ public class ClockAddTest {
         assertEquals("06:41", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void addToNextHour() {
         Clock clock = new Clock(0, 45);
@@ -29,7 +29,7 @@ public class ClockAddTest {
         assertEquals("01:25", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void addMoreThanOneHour() {
         Clock clock = new Clock(10, 0);
@@ -37,7 +37,7 @@ public class ClockAddTest {
         assertEquals("11:01", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void addMoreThanTwoHoursWithCarry() {
         Clock clock = new Clock(0, 45);
@@ -45,7 +45,7 @@ public class ClockAddTest {
         assertEquals("03:25", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void addAcrossMidnight() {
         Clock clock = new Clock(23, 59);
@@ -53,7 +53,7 @@ public class ClockAddTest {
         assertEquals("00:01", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void addMoreThanOneDay() {
         Clock clock = new Clock(5, 32);
@@ -61,7 +61,7 @@ public class ClockAddTest {
         assertEquals("06:32", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void addMoreThanTwoDays() {
         Clock clock = new Clock(1, 1);
@@ -69,7 +69,7 @@ public class ClockAddTest {
         assertEquals("11:21", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void subtractMinutes() {
         Clock clock = new Clock(10, 3);
@@ -77,7 +77,7 @@ public class ClockAddTest {
         assertEquals("10:00", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void subtractToPreviousHour() {
         Clock clock = new Clock(10, 3);
@@ -85,7 +85,7 @@ public class ClockAddTest {
         assertEquals("09:33", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void subtractMoreThanAnHour() {
         Clock clock = new Clock(10, 3);
@@ -93,7 +93,7 @@ public class ClockAddTest {
         assertEquals("08:53", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void subtractAcrossMidnight() {
         Clock clock = new Clock(0, 3);
@@ -101,7 +101,7 @@ public class ClockAddTest {
         assertEquals("23:59", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void subtractMoreThanTwoHours() {
         Clock clock = new Clock(0, 0);
@@ -109,7 +109,7 @@ public class ClockAddTest {
         assertEquals("21:20", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void subtractMoreThanTwoHoursWithBorrow() {
         Clock clock = new Clock(6, 15);
@@ -117,7 +117,7 @@ public class ClockAddTest {
         assertEquals("03:35", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void subtractMoreThanOneDay() {
         Clock clock = new Clock(5, 32);
@@ -125,7 +125,7 @@ public class ClockAddTest {
         assertEquals("04:32", clock.toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void subtractMoreThanTwoDays() {
         Clock clock = new Clock(2, 20);

exercises/clock/src/test/java/ClockCreationTest.java

@@ -10,109 +10,109 @@ public class ClockCreationTest {
         assertEquals("08:00", new Clock(8, 0).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void canPrintTimeWithMinutes() {
         assertEquals("11:09", new Clock(11, 9).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void midnightPrintsAsZero() {
         assertEquals("00:00", new Clock(24, 0).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void hourRollsOver() {
         assertEquals("01:00", new Clock(25, 0).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void hourRollsOverContinuously() {
         assertEquals("04:00", new Clock(100, 0).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void sixtyMinutesIsNextHour() {
         assertEquals("02:00", new Clock(1, 60).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void minutesRollOver() {
         assertEquals("02:40", new Clock(0, 160).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void minutesRollOverContinuously() {
         assertEquals("04:43", new Clock(0, 1723).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void hourAndMinutesRollOver() {
         assertEquals("03:40", new Clock(25, 160).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void hourAndMinutesRollOverContinuously() {
         assertEquals("11:01", new Clock(201, 3001).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void hourAndMinutesRollOverToExactlyMidnight() {
         assertEquals("00:00", new Clock(72, 8640).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void negativeHour() {
         assertEquals("23:15", new Clock(-1, 15).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void negativeHourRollsOver() {
         assertEquals("23:00", new Clock(-25, 0).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void negativeHourRollsOverContinuously() {
         assertEquals("05:00", new Clock(-91, 0).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void negativeMinutes() {
         assertEquals("00:20", new Clock(1, -40).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void negativeMinutesRollOver() {
         assertEquals("22:20", new Clock(1, -160).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void negativeMinutesRollOverContinuously() {
         assertEquals("16:40", new Clock(1, -4820).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void negativeHourAndMinutesBothRollOver() {
         assertEquals("20:20", new Clock(-25, -160).toString());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void negativeHourAndMinutesBothRollOverContinuously() {
         assertEquals("22:10", new Clock(-121, -5810).toString());

exercises/clock/src/test/java/ClockEqualTest.java

@@ -6,91 +6,91 @@ import static org.junit.Assert.assertTrue;
 
 public class ClockEqualTest {
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithSameTimeAreEqual() {
         assertTrue(new Clock(15, 37).equals(new Clock(15, 37)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksAMinuteApartAreNotEqual() {
         assertFalse(new Clock(15, 36).equals(new Clock(15, 37)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksAnHourApartAreNotEqual() {
         assertFalse(new Clock(14, 37).equals(new Clock(15, 37)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithHourOverflow() {
         assertTrue(new Clock(10, 37).equals(new Clock(34, 37)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithHourOverflowBySeveralDays() {
         assertTrue(new Clock(3, 11).equals(new Clock(99, 11)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithNegateHour() {
         assertTrue(new Clock(22, 40).equals(new Clock(-2, 40)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithNegativeHourThatWraps() {
         assertTrue(new Clock(17, 3).equals(new Clock(-31, 3)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithNegativeHourThatWrapsMultipleTimes() {
         assertTrue(new Clock(13, 49).equals(new Clock(-83, 49)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithMinuteOverflow() {
         assertTrue(new Clock(0, 1).equals(new Clock(0, 1441)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithMinuteOverflowBySeveralDays() {
         assertTrue(new Clock(2, 2).equals(new Clock(2, 4322)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithNegativeMinutes() {
         assertTrue(new Clock(2, 40).equals(new Clock(3, -20)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithNegativeMinutesThatWraps() {
         assertTrue(new Clock(4, 10).equals(new Clock(5, -1490)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithNegativeMinutesThatWrapsMultipleTimes() {
         assertTrue(new Clock(6, 15).equals(new Clock(6, -4305)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithNegativeHoursAndMinutes() {
         assertTrue(new Clock(7, 32).equals(new Clock(-12, -268)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void clocksWithNegativeHoursAndMinutesThatWrap() {
         assertTrue(new Clock(18, 7).equals(new Clock(-54, -11513)));

exercises/custom-set/src/test/java/CustomSetTest.java

@@ -18,7 +18,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void setsWithElementsAreNotEmpty() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1))
@@ -28,7 +28,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void nothingIsContainedInAnEmptySet() {
         final boolean actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -38,7 +38,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void whenTheElementIsInTheSet() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1, 2, 3))
@@ -48,7 +48,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void whenTheElementIsNotInTheSet() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1, 2, 3))
@@ -58,7 +58,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void emptySetIsASubsetOfAnotherEmptySet() {
         final boolean actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -70,7 +70,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void emptySetIsASubsetOfNonEemptySet() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1))
@@ -82,7 +82,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void nonEmptySetIsNotASubsetOfEmptySet() {
         final boolean actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -94,7 +94,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void setIsASubsetOfSetWithExactSameElements() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1, 2, 3))
@@ -106,7 +106,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void setIsASubsetOfLargerSetWithSameElements() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(4, 1, 2, 3))
@@ -118,7 +118,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void setIsNotASubsetOfSetThatDoesNotContainItsElements() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(4, 1, 3))
@@ -130,7 +130,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void theEmptySetIsDisjointWithItself() {
         final boolean actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -142,7 +142,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void emptySetIsDisjointWithNonEmptySet() {
         final boolean actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -154,7 +154,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void nonEmptySetIsDisjointWithEmptySet() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1))
@@ -166,7 +166,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void setsAreNotDisjointIfTheyShareAnElement() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1, 2))
@@ -178,7 +178,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void setsAreDisjointIfTheyShareNoElements() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1, 2))
@@ -190,7 +190,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void emptySetsAreEqual() {
         final boolean actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -202,7 +202,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void emptySetIsNotEqualToNonEmptySet() {
         final boolean actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -214,7 +214,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void nonEmptySetIsNotEqualToEmptySet() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1, 2, 3))
@@ -226,7 +226,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void setsWithTheSameElementsAreEqual() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1, 2))
@@ -238,7 +238,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void setsWithDifferentElementsAreNotEqual() {
         final boolean actual
                 = new CustomSet<>(Arrays.asList(1, 2, 3))
@@ -250,7 +250,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void addToEmptySet() {
         final int element = 3;
         final CustomSet<Integer> expected
@@ -268,7 +268,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void addToNonEmptySet() {
         final int element = 3;
         final CustomSet<Integer> expected
@@ -286,7 +286,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void addingAnExistingElementDoesNotChangeTheSet() {
         final int element = 3;
         final CustomSet<Integer> expected
@@ -303,7 +303,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void intersectionOfTwoEmptySetsIsAnEmptySet() {
         final CustomSet<Integer> actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -316,7 +316,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void intersectionOfAnEmptySetAndNonEmptySetIsAnEmptySet() {
         final CustomSet<Integer> actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -329,7 +329,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void intersectionOfANonEmptySetAndAnEmptySetIsAnEmptySet() {
         final CustomSet<Integer> actual
                 = new CustomSet<>(Arrays.asList(1, 2, 3, 4))
@@ -343,7 +343,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void intersectionOfTwoSetsWithNoSharedElementsIsAnEmptySet() {
         final CustomSet<Integer> actual
                 = new CustomSet<>(Arrays.asList(1, 2, 3))
@@ -356,7 +356,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void intersectionOfTwoSetsWithSharedElementsIsASetOfTheSharedElements() {
         final CustomSet<Integer> expected
                 = new CustomSet<>(
@@ -374,7 +374,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void differenceOfTwoEmptySetsIsAnEmptySet() {
         final CustomSet<Integer> actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -387,7 +387,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void differenceOfAnEmptySetAndNonEmptySetIsAnEmptySet() {
         final CustomSet<Integer> actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -400,7 +400,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void differenceOfANonEmptySetAndAnEmptySetIsTheNonEmptySet() {
         final CustomSet<Integer> expected
                 = new CustomSet<>(
@@ -418,7 +418,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void differenceOfTwoNonEmptySetsIsASetOfElementsThatAreOnlyInTheFirstSet() {
         final CustomSet<Integer> expected
                 = new CustomSet<>(
@@ -436,7 +436,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void unionOfTwoEmptySetsIsAnEmptySet() {
         final CustomSet<Integer> actual
                 = new CustomSet<>(Collections.EMPTY_LIST)
@@ -449,7 +449,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void unionOfAnEmptySetAndNonEmptySetIsTheNonEmptySet() {
         final CustomSet<Integer> expected
                 = new CustomSet<>(
@@ -467,7 +467,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void unionOfANonEmptySetAndAnEmptySetIsTheNonEmptySet() {
         final CustomSet<Integer> expected
                 = new CustomSet<>(
@@ -485,7 +485,7 @@ public class CustomSetTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void unionOfTwoNonEmptySetsContainsAllUniqueElements() {
         final CustomSet<Integer> expected
                 = new CustomSet<>(

exercises/diamond/src/test/java/DiamondPrinterTest.java

@@ -23,7 +23,7 @@ public final class DiamondPrinterTest {
         assertThat(output, is(singletonList("A")));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTwoByTwoDiamond() {
         List<String> output = diamondPrinter.printToList('B');
@@ -32,7 +32,7 @@ public final class DiamondPrinterTest {
                                      " A ")));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThreeByThreeDiamond() {
         List<String> output = diamondPrinter.printToList('C');
@@ -43,7 +43,7 @@ public final class DiamondPrinterTest {
                                      "  A  ")));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFiveByFiveDiamond() {
         List<String> output = diamondPrinter.printToList('E');
@@ -58,7 +58,7 @@ public final class DiamondPrinterTest {
                                      "    A    ")));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFullDiamond() {
         List<String> output = diamondPrinter.printToList('Z');

exercises/etl/src/test/java/EtlTest.java

@@ -28,7 +28,7 @@ public class EtlTest {
         assertEquals(expected, etl.transform(old));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTransformMoreValues() {
         Map<Integer, List<String>> old = new HashMap<Integer, List<String>>() {
@@ -52,7 +52,7 @@ public class EtlTest {
         assertEquals(expected, etl.transform(old));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testMoreKeys() {
         Map<Integer, List<String>> old = new HashMap<Integer, List<String>>() {
@@ -76,7 +76,7 @@ public class EtlTest {
         assertEquals(expected, etl.transform(old));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFullDataset() {
         Map<Integer, List<String>> old = new HashMap<Integer, List<String>>() {

exercises/flatten-array/src/test/java/FlattenerTest.java

@@ -30,7 +30,7 @@ public final class FlattenerTest {
                 "two")));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testASingleLevelOfNestingWithNoNulls() {
         assertEquals(
@@ -48,7 +48,7 @@ public final class FlattenerTest {
               8)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFiveLevelsOfNestingWithNoNulls() {
         assertEquals(
@@ -71,7 +71,7 @@ public final class FlattenerTest {
               "-2")));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSixLevelsOfNestingWithNoNulls() {
         assertEquals(
@@ -94,7 +94,7 @@ public final class FlattenerTest {
               "8")));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSixLevelsOfNestingWithNulls() {
         assertEquals(
@@ -118,7 +118,7 @@ public final class FlattenerTest {
               "negative two")));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNestedListsFullOfNullsOnly() {
         assertEquals(

exercises/grade-school/src/test/java/SchoolTest.java

@@ -28,14 +28,14 @@ public class SchoolTest {
     assertThat(school.numberOfStudents(), is(0));
   }
 
-  @Ignore
+  @Ignore("Remove to run test")
   @Test
   public void addsStudents() {
     school.add("Aimee", 2);
     assertThat(school.grade(2), hasItem("Aimee"));
   }
 
-  @Ignore
+  @Ignore("Remove to run test")
   @Test
   public void addsMoreStudentsInSameGrade() {
     final int grade = 2;
@@ -47,7 +47,7 @@ public class SchoolTest {
     assertThat(school.grade(grade), allOf(hasItem("James"), hasItem("Blair"), hasItem("Paul")));
   }
 
-  @Ignore
+  @Ignore("Remove to run test")
   @Test
   public void addsStudentsInMultipleGrades() {
     school.add("Chelsea", 3);
@@ -60,13 +60,13 @@ public class SchoolTest {
     assertThat(school.grade(7), hasItem("Logan"));
   }
 
-  @Ignore
+  @Ignore("Remove to run test")
   @Test
   public void getsStudentsInEmptyGrade() {
     assertTrue(school.grade(1).isEmpty());
   }
 
-  @Ignore
+  @Ignore("Remove to run test")
   @Test
   public void sortsSchool() {
     school.add("Kyle", 4);
@@ -91,7 +91,7 @@ public class SchoolTest {
     }
   }
 
-  @Ignore
+  @Ignore("Remove to run test")
   @Test
   public void modifyingFetchedGradeShouldNotModifyInternalDatabase() {
     String shouldNotBeAdded = "Should not be added to school";
@@ -109,7 +109,7 @@ public class SchoolTest {
     assertThat(school.grade(grade), not(hasItem(shouldNotBeAdded)));
   }
 
-  @Ignore
+  @Ignore("Remove to run test")
   @Test
   public void modifyingSortedStudentsShouldNotModifyInternalDatabase() {
     int grade = 2;

exercises/hamming/src/test/java/HammingTest.java

@@ -16,51 +16,51 @@ public class HammingTest {
         assertThat(new Hamming("A", "A").getHammingDistance(), is(0));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testHammingDistanceForSingleNucleotideStrand() {
         assertThat(new Hamming("A", "G").getHammingDistance(), is(1));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testHammingDistanceForSmallStrand() {
         assertThat(new Hamming("AG", "CT").getHammingDistance(), is(2));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSmallHammingDistance() {
         assertThat(new Hamming("AT", "CT").getHammingDistance(), is(1));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSmallHammingDistanceInLongerStrand() {
         assertThat(new Hamming("GGACG", "GGTCG").getHammingDistance(), is(1));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testValidatesFirstStrandNotLonger() {
         thrown.expect(IllegalArgumentException.class);
         new Hamming("AAAG", "AAA");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testValidatesOtherStrandNotLonger() {
         thrown.expect(IllegalArgumentException.class);
         new Hamming("AAA", "AAAG");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLargeHammingDistance() {
         assertThat(new Hamming("GATACA", "GCATAA").getHammingDistance(), is(4));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testHammingDistanceInVeryLongStrand() {
         assertThat(new Hamming("GGACGGATTCTG", "AGGACGGATTCT").getHammingDistance(), is(9));

exercises/isogram/src/test/java/IsogramCheckerTest.java

@@ -11,63 +11,63 @@ public class IsogramCheckerTest {
         assertTrue(iso.isIsogram("duplicates"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNotIsogram() {
         IsogramChecker iso = new IsogramChecker();
         assertFalse(iso.isIsogram("eleven"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testMediumLongIsogram() {
         IsogramChecker iso = new IsogramChecker();
         assertTrue(iso.isIsogram("subdermatoglyphic"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCaseInsensitive() {
         IsogramChecker iso = new IsogramChecker();
         assertFalse(iso.isIsogram("Alphabet"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testIsogramWithHyphen() {
         IsogramChecker iso = new IsogramChecker();
         assertTrue(iso.isIsogram("thumbscrew-japingly"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testIgnoresMultipleHyphens() {
         IsogramChecker iso = new IsogramChecker();
         assertTrue(iso.isIsogram("Hjelmqvist-Gryb-Zock-Pfund-Wax"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testWorksWithGermanLetters() {
         IsogramChecker iso = new IsogramChecker();
         assertTrue(iso.isIsogram("Heizölrückstoßabdämpfung"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testIgnoresSpaces() {
         IsogramChecker iso = new IsogramChecker();
         assertFalse(iso.isIsogram("the quick brown fox"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testIgnoresSpaces2() {
         IsogramChecker iso = new IsogramChecker();
         assertTrue(iso.isIsogram("Emily Jung Schwartzkopf"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testDuplicateAccentedLetters() {
         IsogramChecker iso = new IsogramChecker();

exercises/largest-series-product/src/test/java/LargestSeriesProductCalculatorTest.java

@@ -24,7 +24,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductOfLengthTwoWithNumbersNotInOrder() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("576802143");
@@ -35,7 +35,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductWhenSeriesLengthEqualsStringToSearchLength() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("29");
@@ -46,7 +46,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductOfLengthThreeWithNumbersInOrder() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("0123456789");
@@ -57,7 +57,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductOfLengthThreeWithNumbersNotInOrder() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("1027839564");
@@ -68,7 +68,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductOfLengthFiveWithNumbersInOrder() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("0123456789");
@@ -79,7 +79,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductInLongStringToSearchV1() {
         final LargestSeriesProductCalculator calculator
@@ -92,7 +92,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductInLongStringToSearchV2() {
         final LargestSeriesProductCalculator calculator
@@ -105,7 +105,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductInLongStringToSearchFromProjectEuler() {
         final LargestSeriesProductCalculator calculator
@@ -118,7 +118,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductOfZeroIfAllDigitsAreZeroes() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("0000");
@@ -129,7 +129,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductOfZeroIfAllSeriesOfGivenLengthContainZero() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("99099");
@@ -140,7 +140,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSeriesLengthLongerThanLengthOfStringToTestIsRejected() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("123");
@@ -152,7 +152,7 @@ public final class LargestSeriesProductCalculatorTest {
         calculator.calculateLargestProductForSeriesLength(4);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductOfLength0ForEmptyStringToSearch() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("");
@@ -163,7 +163,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCorrectlyCalculatesLargestProductOfLength0ForNonEmptyStringToSearch() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("123");
@@ -174,7 +174,7 @@ public final class LargestSeriesProductCalculatorTest {
         assertEquals(expectedProduct, actualProduct);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testEmptyStringToSearchAndSeriesOfNonZeroLengthIsRejected() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("");
@@ -186,7 +186,7 @@ public final class LargestSeriesProductCalculatorTest {
         calculator.calculateLargestProductForSeriesLength(1);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testStringToSearchContainingNonDigitCharacterIsRejected() {
         expectedException.expect(IllegalArgumentException.class);
@@ -195,7 +195,7 @@ public final class LargestSeriesProductCalculatorTest {
         new LargestSeriesProductCalculator("1234a5");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNegativeSeriesLengthIsRejected() {
         final LargestSeriesProductCalculator calculator = new LargestSeriesProductCalculator("12345");
@@ -206,7 +206,7 @@ public final class LargestSeriesProductCalculatorTest {
         calculator.calculateLargestProductForSeriesLength(-1);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNullStringToSearchIsRejected() {
         expectedException.expect(IllegalArgumentException.class);

exercises/linked-list/src/test/java/DoublyLinkedListTest.java

@@ -22,7 +22,7 @@ public class DoublyLinkedListTest {
         assertThat(subject.pop(), is(10));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testPushShift() {
         subject.push(10);
@@ -31,7 +31,7 @@ public class DoublyLinkedListTest {
         assertThat(subject.shift(), is(20));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testUnshiftShift() {
         subject.unshift(10);
@@ -40,7 +40,7 @@ public class DoublyLinkedListTest {
         assertThat(subject.shift(), is(10));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testUnshiftPop() {
         subject.unshift(10);
@@ -49,7 +49,7 @@ public class DoublyLinkedListTest {
         assertThat(subject.pop(), is(20));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testExample() {
         subject.push(10);

exercises/list-ops/src/test/java/ListOpsTest.java

@@ -29,7 +29,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldReturnTheCorrectLengthOfAnNonEmptyList() {
         final List<Integer> list = Collections.unmodifiableList(
                 Arrays.asList(0, 1, 2, 3, 4)
@@ -41,7 +41,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldReverseAnEmptyList() {
         final List<Integer> actual = ListOps.reverse(EMPTY_LIST);
 
@@ -50,7 +50,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldReverseANonEmptyList() {
         final List<Integer> list = Collections.unmodifiableList(
                 Arrays.asList(0, 1, 2, 3, 4, 5, 6, 7, 8)
@@ -66,7 +66,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldMapAnEmptyListAndReturnAnEmptyList() {
         final List<Integer> actual = ListOps.map(EMPTY_LIST, x -> x + 1);
 
@@ -75,7 +75,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldMapNonEmptyList() {
         final List<Integer> list
                 = Collections.unmodifiableList(Arrays.asList(1, 3, 5, 7));
@@ -87,7 +87,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldFilterAnEmptyListanddReturnAnEmptyList() {
         final List<Integer> actual = ListOps.filter(EMPTY_LIST, x -> x > 0);
 
@@ -96,7 +96,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldFilterNonEmptyList() {
         Predicate<Integer> predicate = x -> x % 2 > 0;
         final List<Integer> list = Collections.unmodifiableList(
@@ -113,7 +113,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldConcatenateZeroLists() {
         List<Integer> actual = ListOps.concat();
 
@@ -122,7 +122,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldConcatenateOneNonEmptyList() {
         final List<Integer> list
                 = Collections.unmodifiableList(
@@ -137,7 +137,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldConcatenateOneEmptyList() {
         final List<Integer> actual = ListOps.concat(EMPTY_LIST);
 
@@ -146,7 +146,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldConcatenateTwoEmptyLists() {
         final List<Integer> actual = ListOps.concat(EMPTY_LIST, EMPTY_LIST);
 
@@ -155,7 +155,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldConcatenateOneEmptyAndOneNonEmptyLists() {
         final List<Integer> list
                 = Collections.unmodifiableList(
@@ -171,7 +171,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldConcatenateOneNonEmptyAndOneEmptyLists() {
         final List<Integer> list
                 = Collections.unmodifiableList(
@@ -187,7 +187,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldConcatenateTwoListsWithSameElements() {
         final List<Integer> list1 = Collections.unmodifiableList(
                 Arrays.asList(0, 1, 2, 3, 4)
@@ -205,7 +205,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldConcatenateSeveralLists() {
         final List<Integer> list1 = Collections.unmodifiableList(
                 Arrays.asList(0, 1, 2, 3)
@@ -232,7 +232,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldReturnIdentityWhenAnEmptyListIsReduced() {
         final int expected = 0;
         final int actual
@@ -242,7 +242,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldCalculateTheSumOfANonEmptyIntegerList() {
         final List<Integer> list = Collections.unmodifiableList(
                 Arrays.asList(0, 1, 2, 3, 4)
@@ -273,7 +273,7 @@ public class ListOpsTest {
             };
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldReduceAnEmptyListAndANonEmptyListAndReturnConcatenation() {
         final List<Integer> list = Collections.unmodifiableList(
                 Arrays.asList(0, 1, 2, 3, 4, 5)
@@ -292,7 +292,7 @@ public class ListOpsTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldReduceTwoNonEmptyListsAndReturnConcatenation() {
         final List<Integer> listOne = Collections.unmodifiableList(
                 Arrays.asList(0, 1, 2, 3, 4)

exercises/luhn/src/test/java/LuhnValidatorTest.java

@@ -18,73 +18,73 @@ public class LuhnValidatorTest {
         assertFalse(luhnValidator.isValid("1"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatTheStringConsistingOfASingleZeroIsInvalid() {
         assertFalse(luhnValidator.isValid("0"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatASimpleValidNumberIsIdentifiedAsValid() {
         assertTrue(luhnValidator.isValid(" 5 9 "));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatAValidCanadianSocialInsuranceNumberIsIdentifiedAsValidV1() {
         assertTrue(luhnValidator.isValid("046 454 286"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatAValidCanadianSocialInsuranceNumberIsIdentifiedAsValidV2() {
         assertTrue(luhnValidator.isValid("055 444 285"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatAnInvalidCanadianSocialInsuranceNumberIsIdentifiedAsInvalid() {
         assertFalse(luhnValidator.isValid("046 454 287"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatAnInvalidCreditCardIsIdentifiedAsInvalid() {
         assertFalse(luhnValidator.isValid("8273 1232 7352 0569"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatAddingANonDigitCharacterToAValidStringInvalidatesTheString() {
         assertFalse(luhnValidator.isValid("046a 454 286"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatStringContainingPunctuationIsInvalid() {
         assertFalse(luhnValidator.isValid("055-444-285"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatStringContainingSymbolsIsInvalid() {
         assertFalse(luhnValidator.isValid("055£ 444$ 285"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatTheStringConsistingOfASpaceAndASingleZeroIsInvalid() {
         assertFalse(luhnValidator.isValid(" 0"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatStringContainingMultipleZerosIsValid() {
         assertTrue(luhnValidator.isValid(" 00000"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatDoublingNineIsHandledCorrectly() {
         assertTrue(luhnValidator.isValid("091"));

exercises/matrix/src/test/java/MatrixTest.java

@@ -44,7 +44,7 @@ public class MatrixTest {
         }
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @RunWith(Parameterized.class)
     public static class CountColumnsTest {
         private Matrix matrix;
@@ -76,7 +76,7 @@ public class MatrixTest {
         }
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @RunWith(Parameterized.class)
     public static class GetFirstRowTest {
         private Matrix matrix;
@@ -108,7 +108,7 @@ public class MatrixTest {
         }
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @RunWith(Parameterized.class)
     public static class GetLastRowTest {
         private Matrix matrix;
@@ -140,7 +140,7 @@ public class MatrixTest {
         }
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @RunWith(Parameterized.class)
     public static class GetFirstColumnTest {
         private Matrix matrix;
@@ -173,7 +173,7 @@ public class MatrixTest {
     }
 
 
-    @Ignore
+    @Ignore("Remove to run test")
     @RunWith(Parameterized.class)
     public static class GetLastColumnTest {
         private Matrix matrix;

exercises/meetup/src/test/java/MeetupTest.java

@@ -16,7 +16,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testMonteenthOfAugust2013() {
         LocalDate expected = LocalDate.of(2013, 8, 19);
@@ -24,7 +24,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testMonteenthOfSeptember2013() {
         LocalDate expected = LocalDate.of(2013, 9, 16);
@@ -32,7 +32,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTuesteenthOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 19);
@@ -40,7 +40,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTuesteenthOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 16);
@@ -48,7 +48,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTuesteenthOfAugust2013() {
         LocalDate expected = LocalDate.of(2013, 8, 13);
@@ -56,7 +56,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testWednesteenthOfJanuary2013() {
         LocalDate expected = LocalDate.of(2013, 1, 16);
@@ -64,7 +64,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testWednesteenthOfFebruary2013() {
         LocalDate expected = LocalDate.of(2013, 2, 13);
@@ -72,7 +72,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testWednesteenthOfJune2013() {
         LocalDate expected = LocalDate.of(2013, 6, 19);
@@ -80,7 +80,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThursteenthOfMay2013() {
         LocalDate expected = LocalDate.of(2013, 5, 16);
@@ -88,7 +88,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThursteenthOfJune2013() {
         LocalDate expected = LocalDate.of(2013, 6, 13);
@@ -96,7 +96,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThursteenthOfSeptember2013() {
         LocalDate expected = LocalDate.of(2013, 9, 19);
@@ -104,7 +104,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFriteenthOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 19);
@@ -112,7 +112,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFriteenthOfAugust2013() {
         LocalDate expected = LocalDate.of(2013, 8, 16);
@@ -120,7 +120,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFriteenthOfSeptember2013() {
         LocalDate expected = LocalDate.of(2013, 9, 13);
@@ -128,7 +128,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSaturteenthOfFebruary2013() {
         LocalDate expected = LocalDate.of(2013, 2, 16);
@@ -136,7 +136,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSaturteenthOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 13);
@@ -144,7 +144,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSaturteenthOfOctober2013() {
         LocalDate expected = LocalDate.of(2013, 10, 19);
@@ -152,7 +152,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSunteenthOfMay2013() {
         LocalDate expected = LocalDate.of(2013, 5, 19);
@@ -160,7 +160,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSunteenthOfJune2013() {
         LocalDate expected = LocalDate.of(2013, 6, 16);
@@ -168,7 +168,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSunteenthOfOctober2013() {
         LocalDate expected = LocalDate.of(2013, 10, 13);
@@ -176,7 +176,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.TEENTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstMondayOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 4);
@@ -184,7 +184,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstMondayOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 1);
@@ -192,7 +192,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstTuesdayOfMay2013() {
         LocalDate expected = LocalDate.of(2013, 5, 7);
@@ -200,7 +200,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstTuesdayOfJune2013() {
         LocalDate expected = LocalDate.of(2013, 6, 4);
@@ -208,7 +208,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstWednesdayOfJuly2013() {
         LocalDate expected = LocalDate.of(2013, 7, 3);
@@ -216,7 +216,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstWednesdayOfAugust2013() {
         LocalDate expected = LocalDate.of(2013, 8, 7);
@@ -224,7 +224,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstThursdayOfSeptember2013() {
         LocalDate expected = LocalDate.of(2013, 9, 5);
@@ -232,7 +232,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstThursdayOfOctober2013() {
         LocalDate expected = LocalDate.of(2013, 10, 3);
@@ -240,7 +240,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstFridayOfNovember2013() {
         LocalDate expected = LocalDate.of(2013, 11, 1);
@@ -248,7 +248,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstFridayOfDecember2013() {
         LocalDate expected = LocalDate.of(2013, 12, 6);
@@ -256,7 +256,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstSaturdayOfJanuary2013() {
         LocalDate expected = LocalDate.of(2013, 1, 5);
@@ -264,7 +264,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstSaturdayOfFebruary2013() {
         LocalDate expected = LocalDate.of(2013, 2, 2);
@@ -272,7 +272,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstSundayOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 3);
@@ -280,7 +280,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstSundayOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 7);
@@ -288,7 +288,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.FIRST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondMondayOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 11);
@@ -296,7 +296,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondMondayOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 8);
@@ -304,7 +304,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondTuesdayOfMay2013() {
         LocalDate expected = LocalDate.of(2013, 5, 14);
@@ -312,7 +312,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondTuesdayOfJune2013() {
         LocalDate expected = LocalDate.of(2013, 6, 11);
@@ -320,7 +320,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondWednesdayOfJuly2013() {
         LocalDate expected = LocalDate.of(2013, 7, 10);
@@ -328,7 +328,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondWednesdayOfAugust2013() {
         LocalDate expected = LocalDate.of(2013, 8, 14);
@@ -336,7 +336,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondThursdayOfSeptember2013() {
         LocalDate expected = LocalDate.of(2013, 9, 12);
@@ -344,7 +344,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondThursdayOfOctober2013() {
         LocalDate expected = LocalDate.of(2013, 10, 10);
@@ -352,7 +352,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondFridayOfNovember2013() {
         LocalDate expected = LocalDate.of(2013, 11, 8);
@@ -360,7 +360,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondFridayOfDecember2013() {
         LocalDate expected = LocalDate.of(2013, 12, 13);
@@ -368,7 +368,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondSaturdayOfJanuary2013() {
         LocalDate expected = LocalDate.of(2013, 1, 12);
@@ -376,7 +376,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondSaturdayOfFebruary2013() {
         LocalDate expected = LocalDate.of(2013, 2, 9);
@@ -384,7 +384,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondSundayOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 10);
@@ -392,7 +392,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondSundayOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 14);
@@ -400,7 +400,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.SECOND));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdMondayOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 18);
@@ -408,7 +408,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdMondayOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 15);
@@ -416,7 +416,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdTuesdayOfMay2013() {
         LocalDate expected = LocalDate.of(2013, 5, 21);
@@ -424,7 +424,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdTuesdayOfJune2013() {
         LocalDate expected = LocalDate.of(2013, 6, 18);
@@ -432,7 +432,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdWednesdayOfJuly2013() {
         LocalDate expected = LocalDate.of(2013, 7, 17);
@@ -440,7 +440,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdWednesdayOfAugust2013() {
         LocalDate expected = LocalDate.of(2013, 8, 21);
@@ -448,7 +448,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdThursdayOfSeptember2013() {
         LocalDate expected = LocalDate.of(2013, 9, 19);
@@ -456,7 +456,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdThursdayOfOctober2013() {
         LocalDate expected = LocalDate.of(2013, 10, 17);
@@ -464,7 +464,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdFridayOfNovember2013() {
         LocalDate expected = LocalDate.of(2013, 11, 15);
@@ -472,7 +472,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdFridayOfDecember2013() {
         LocalDate expected = LocalDate.of(2013, 12, 20);
@@ -480,7 +480,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdSaturdayOfJanuary2013() {
         LocalDate expected = LocalDate.of(2013, 1, 19);
@@ -488,7 +488,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdSaturdayOfFebruary2013() {
         LocalDate expected = LocalDate.of(2013, 2, 16);
@@ -496,7 +496,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdSundayOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 17);
@@ -504,7 +504,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThirdSundayOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 21);
@@ -512,7 +512,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.THIRD));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthMondayOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 25);
@@ -520,7 +520,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthMondayOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 22);
@@ -528,7 +528,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthTuesdayOfMay2013() {
         LocalDate expected = LocalDate.of(2013, 5, 28);
@@ -536,7 +536,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthTuesdayOfJune2013() {
         LocalDate expected = LocalDate.of(2013, 6, 25);
@@ -544,7 +544,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthWednesdayOfJuly2013() {
         LocalDate expected = LocalDate.of(2013, 7, 24);
@@ -552,7 +552,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthWednesdayOfAugust2013() {
         LocalDate expected = LocalDate.of(2013, 8, 28);
@@ -560,7 +560,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthThursdayOfSeptember2013() {
         LocalDate expected = LocalDate.of(2013, 9, 26);
@@ -568,7 +568,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthThursdayOfOctober2013() {
         LocalDate expected = LocalDate.of(2013, 10, 24);
@@ -576,7 +576,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthFridayOfNovember2013() {
         LocalDate expected = LocalDate.of(2013, 11, 22);
@@ -584,7 +584,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthFridayOfDecember2013() {
         LocalDate expected = LocalDate.of(2013, 12, 27);
@@ -592,7 +592,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthSaturdayOfJanuary2013() {
         LocalDate expected = LocalDate.of(2013, 1, 26);
@@ -600,7 +600,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthSaturdayOfFebruary2013() {
         LocalDate expected = LocalDate.of(2013, 2, 23);
@@ -608,7 +608,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthSundayOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 24);
@@ -616,7 +616,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFourthSundayOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 28);
@@ -624,7 +624,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.FOURTH));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastMondayOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 25);
@@ -632,7 +632,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastMondayOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 29);
@@ -640,7 +640,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.MONDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastTuesdayOfMay2013() {
         LocalDate expected = LocalDate.of(2013, 5, 28);
@@ -648,7 +648,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastTuesdayOfJune2013() {
         LocalDate expected = LocalDate.of(2013, 6, 25);
@@ -656,7 +656,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.TUESDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastWednesdayOfJuly2013() {
         LocalDate expected = LocalDate.of(2013, 7, 31);
@@ -664,7 +664,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastWednesdayOfAugust2013() {
         LocalDate expected = LocalDate.of(2013, 8, 28);
@@ -672,7 +672,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.WEDNESDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastThursdayOfSeptember2013() {
         LocalDate expected = LocalDate.of(2013, 9, 26);
@@ -680,7 +680,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastThursdayOfOctober2013() {
         LocalDate expected = LocalDate.of(2013, 10, 31);
@@ -688,7 +688,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.THURSDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastFridayOfNovember2013() {
         LocalDate expected = LocalDate.of(2013, 11, 29);
@@ -696,7 +696,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastFridayOfDecember2013() {
         LocalDate expected = LocalDate.of(2013, 12, 27);
@@ -704,7 +704,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.FRIDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastSaturdayOfJanuary2013() {
         LocalDate expected = LocalDate.of(2013, 1, 26);
@@ -712,7 +712,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastSaturdayOfFebruary2013() {
         LocalDate expected = LocalDate.of(2013, 2, 23);
@@ -720,7 +720,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SATURDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastSundayOfMarch2013() {
         LocalDate expected = LocalDate.of(2013, 3, 31);
@@ -728,7 +728,7 @@ public class MeetupTest {
         assertEquals(expected, meetup.day(DayOfWeek.SUNDAY, MeetupSchedule.LAST));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLastSundayOfApril2013() {
         LocalDate expected = LocalDate.of(2013, 4, 28);

exercises/minesweeper/src/test/java/MinesweeperBoardTest.java

@@ -28,7 +28,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithOneRowAndNoColumns() {
         final List<String> inputBoard = Collections.singletonList("");
@@ -39,7 +39,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithNoMines() {
         final List<String> inputBoard = Arrays.asList(
@@ -60,7 +60,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithOnlyMines() {
         final List<String> inputBoard = Arrays.asList(
@@ -81,7 +81,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithSingleMineAtCenter() {
         final List<String> inputBoard = Arrays.asList(
@@ -102,7 +102,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithMinesAroundPerimeter() {
         final List<String> inputBoard = Arrays.asList(
@@ -123,7 +123,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithSingleRowAndTwoMines() {
         final List<String> inputBoard = Collections.singletonList(
@@ -140,7 +140,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithSingleRowAndTwoMinesAtEdges() {
         final List<String> inputBoard = Collections.singletonList(
@@ -157,7 +157,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithSingleColumnAndTwoMines() {
         final List<String> inputBoard = Arrays.asList(
@@ -182,7 +182,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithSingleColumnAndTwoMinesAtEdges() {
         final List<String> inputBoard = Arrays.asList(
@@ -207,7 +207,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithMinesInCross() {
         final List<String> inputBoard = Arrays.asList(
@@ -232,7 +232,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLargeInputBoard() {
         final List<String> inputBoard = Arrays.asList(
@@ -259,7 +259,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNullInputBoardIsRejected() {
         expectedException.expect(IllegalArgumentException.class);
@@ -268,7 +268,7 @@ public final class MinesweeperBoardTest {
         new MinesweeperBoard(null);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithInvalidSymbolsIsRejected() {
         expectedException.expect(IllegalArgumentException.class);
@@ -277,7 +277,7 @@ public final class MinesweeperBoardTest {
         new MinesweeperBoard(Collections.singletonList(" * & "));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithInconsistentRowLengthsIsRejected() {
         expectedException.expect(IllegalArgumentException.class);

exercises/nth-prime/src/test/java/PrimeCalculatorTest.java

@@ -23,25 +23,25 @@ public class PrimeCalculatorTest {
         assertThat(primeCalculator.nth(1), is(2));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondPrime() {
         assertThat(primeCalculator.nth(2), is(3));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSixthPrime() {
         assertThat(primeCalculator.nth(6), is(13));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testBigPrime() {
         assertThat(primeCalculator.nth(10001), is(104743));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testUndefinedPrime() {
         thrown.expect(IllegalArgumentException.class);

exercises/nucleotide-count/src/test/java/NucleotideTest.java

@@ -19,7 +19,7 @@ public class NucleotideTest {
         assertThat(dna.count('A'), is(0));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testEmptyDnaStringHasNoNucleotides() {
         DNA dna = new DNA("");
@@ -33,14 +33,14 @@ public class NucleotideTest {
         ));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testRepetitiveCytosineGetsCounted() {
         DNA dna = new DNA("CCCCC");
         assertThat(dna.count('C'), is(5));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testRepetitiveSequenceWithOnlyGuanine() {
         DNA dna = new DNA("GGGGGGGG");
@@ -54,14 +54,14 @@ public class NucleotideTest {
         ));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCountsOnlyThymine() {
         DNA dna = new DNA("GGGGGTAACCCGG");
         assertThat(dna.count('T'), is(1));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCountsANucleotideOnlyOnce() {
         DNA dna = new DNA("CGATTGGG");
@@ -69,7 +69,7 @@ public class NucleotideTest {
         assertThat(dna.count('T'), is(2));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testDnaCountsDoNotChangeAfterCountingAdenine() {
         DNA dna = new DNA("GATTACA");
@@ -84,7 +84,7 @@ public class NucleotideTest {
         ));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testValidatesNucleotides() {
         thrown.expect(IllegalArgumentException.class);
@@ -92,7 +92,7 @@ public class NucleotideTest {
         dna.count('X');
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCountsAllNucleotides() {
         String s = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";

exercises/palindrome-products/src/test/java/PalindromeCalculatorTest.java

@@ -34,7 +34,7 @@ public class PalindromeCalculatorTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void largestPalindromeFromDoubleDigitFactors() {
         final List<List<Integer>> expected = Collections.unmodifiableList(
                 Arrays.asList(
@@ -49,7 +49,7 @@ public class PalindromeCalculatorTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void smallestPalindromeFromDoubleDigitFactors() {
         final List<List<Integer>> expected = Collections.unmodifiableList(
                 Arrays.asList(
@@ -64,7 +64,7 @@ public class PalindromeCalculatorTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void largestPalindromeFromTripleDigitFactors() {
         final List<List<Integer>> expected = Collections.unmodifiableList(
                 Arrays.asList(
@@ -79,7 +79,7 @@ public class PalindromeCalculatorTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void smallestPalindromeFromTripleDigitFactors() {
         final List<List<Integer>> expected = Collections.unmodifiableList(
                 Arrays.asList(

exercises/pascals-triangle/src/test/java/PascalsTriangleGeneratorTest.java

@@ -30,7 +30,7 @@ public class PascalsTriangleGeneratorTest {
         assertArrayEquals(expectedOutput, pascalsTriangleGenerator.generateTriangle(0));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTriangleWithOneRow() {
         int[][] expectedOutput = new int[][]{
@@ -40,7 +40,7 @@ public class PascalsTriangleGeneratorTest {
         assertArrayEquals(expectedOutput, pascalsTriangleGenerator.generateTriangle(1));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTriangleWithTwoRows() {
         int[][] expectedOutput = new int[][]{
@@ -51,7 +51,7 @@ public class PascalsTriangleGeneratorTest {
         assertArrayEquals(expectedOutput, pascalsTriangleGenerator.generateTriangle(2));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTriangleWithThreeRows() {
         int[][] expectedOutput = new int[][]{
@@ -63,7 +63,7 @@ public class PascalsTriangleGeneratorTest {
         assertArrayEquals(expectedOutput, pascalsTriangleGenerator.generateTriangle(3));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTriangleWithFourRows() {
         int[][] expectedOutput = new int[][]{
@@ -76,7 +76,7 @@ public class PascalsTriangleGeneratorTest {
         assertArrayEquals(expectedOutput, pascalsTriangleGenerator.generateTriangle(4));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testValidatesNotNegativeRows() {
         thrown.expect(IllegalArgumentException.class);

exercises/phone-number/src/test/java/PhoneNumberTest.java

@@ -25,7 +25,7 @@ public class PhoneNumberTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cleansNumberWithDots() {
         final String expectedNumber = "1234567890";
@@ -36,7 +36,7 @@ public class PhoneNumberTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cleansNumberWithMultipleSpaces() {
         final String expectedNumber = "1234567890";
@@ -47,7 +47,7 @@ public class PhoneNumberTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWhen9Digits() {
         expectedException.expect(IllegalArgumentException.class);
@@ -55,7 +55,7 @@ public class PhoneNumberTest {
         new PhoneNumber("123456789");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWhen11Digits() {
         expectedException.expect(IllegalArgumentException.class);
@@ -63,7 +63,7 @@ public class PhoneNumberTest {
         new PhoneNumber("21234567890");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void validWhen11DigitsAndFirstIs1() {
         final String expectedNumber = "1234567890";
@@ -74,7 +74,7 @@ public class PhoneNumberTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWhen12Digits() {
         expectedException.expect(IllegalArgumentException.class);
@@ -82,7 +82,7 @@ public class PhoneNumberTest {
         new PhoneNumber("321234567890");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWithLetters() {
         expectedException.expect(IllegalArgumentException.class);
@@ -90,7 +90,7 @@ public class PhoneNumberTest {
         new PhoneNumber("123-abc-7890");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWithPunctuation() {
         expectedException.expect(IllegalArgumentException.class);
@@ -98,7 +98,7 @@ public class PhoneNumberTest {
         new PhoneNumber("123-@:!-7890");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWithRightNumberOfDigitsButLettersMixedIn() {
         expectedException.expect(IllegalArgumentException.class);

exercises/pythagorean-triplet/src/test/java/PythagoreanTripletTest.java

@@ -21,7 +21,7 @@ public class PythagoreanTripletTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldCalculateProduct() {
         PythagoreanTriplet sut = new PythagoreanTriplet(3, 4, 5);
         final long expected = 60l;
@@ -30,21 +30,21 @@ public class PythagoreanTripletTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testIsPythagoreanOK() {
         PythagoreanTriplet sut = new PythagoreanTriplet(3, 4, 5);
         assertTrue(sut.isPythagorean());
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testIsPythagoreanFail() {
         PythagoreanTriplet sut = new PythagoreanTriplet(5, 6, 7);
         assertFalse(sut.isPythagorean());
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldMakeTripletsUpToTen() {
         final List<Long> actual
                 = PythagoreanTriplet
@@ -60,7 +60,7 @@ public class PythagoreanTripletTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldMakeTripletsElevenToTwenty() {
         final List<Long> actual
                 = PythagoreanTriplet
@@ -77,7 +77,7 @@ public class PythagoreanTripletTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldMakeTripletsAndFilterOnSum() {
         final List<Long> actual
                 = PythagoreanTriplet

exercises/queen-attack/src/test/java/QueenAttackCalculatorTest.java

@@ -23,7 +23,7 @@ public final class QueenAttackCalculatorTest {
         assertFalse(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnTheSameRank() {
         final QueenAttackCalculator calculator
@@ -32,7 +32,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnTheSameFile() {
         final QueenAttackCalculator calculator
@@ -41,7 +41,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnFirstDiagonal() {
         final QueenAttackCalculator calculator
@@ -50,7 +50,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnSecondDiagonal() {
         final QueenAttackCalculator calculator
@@ -59,7 +59,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnThirdDiagonal() {
         final QueenAttackCalculator calculator
@@ -68,7 +68,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnFourthDiagonal() {
         final QueenAttackCalculator calculator
@@ -77,7 +77,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCoordinateWithNegativeRankNotAllowed() {
         expectedException.expect(IllegalArgumentException.class);
@@ -86,7 +86,7 @@ public final class QueenAttackCalculatorTest {
         new BoardCoordinate(-2, 2);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCoordinateWithRankGreaterThan7NotAllowed() {
         expectedException.expect(IllegalArgumentException.class);
@@ -95,7 +95,7 @@ public final class QueenAttackCalculatorTest {
         new BoardCoordinate(8, 4);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCoordinateWithNegativeFileNotAllowed() {
         expectedException.expect(IllegalArgumentException.class);
@@ -104,7 +104,7 @@ public final class QueenAttackCalculatorTest {
         new BoardCoordinate(2, -2);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCoordinateWithFileGreaterThan7NotAllowed() {
         expectedException.expect(IllegalArgumentException.class);
@@ -113,7 +113,7 @@ public final class QueenAttackCalculatorTest {
         new BoardCoordinate(4, 8);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNullCoordinateNotAllowed() {
         expectedException.expect(IllegalArgumentException.class);
@@ -122,7 +122,7 @@ public final class QueenAttackCalculatorTest {
         new QueenAttackCalculator(null, new BoardCoordinate(0, 7));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensMustNotOccupyTheSameSquare() {
         expectedException.expect(IllegalArgumentException.class);

exercises/rectangles/src/test/java/RectangleCounterTest.java

@@ -20,7 +20,7 @@ public final class RectangleCounterTest {
         assertEquals(0, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNonTrivialInputWithNoRectangles() {
         String[] inputGrid = new String[]{" "};
@@ -28,7 +28,7 @@ public final class RectangleCounterTest {
         assertEquals(0, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputWithOneRectangle() {
         String[] inputGrid = new String[]{
@@ -40,7 +40,7 @@ public final class RectangleCounterTest {
         assertEquals(1, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputWithTwoRectanglesWithoutSharedEdges() {
         String[] inputGrid = new String[]{
@@ -54,7 +54,7 @@ public final class RectangleCounterTest {
         assertEquals(2, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputWithFiveRectanglesWithSharedEdges() {
         String[] inputGrid = new String[]{
@@ -68,7 +68,7 @@ public final class RectangleCounterTest {
         assertEquals(5, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatRectangleOfHeightOneIsCounted() {
         String[] inputGrid = new String[]{
@@ -79,7 +79,7 @@ public final class RectangleCounterTest {
         assertEquals(1, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatRectangleOfWidthOneIsCounted() {
         String[] inputGrid = new String[]{
@@ -91,7 +91,7 @@ public final class RectangleCounterTest {
         assertEquals(1, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatOneByOneSquareIsCounted() {
         String[] inputGrid = new String[]{
@@ -102,7 +102,7 @@ public final class RectangleCounterTest {
         assertEquals(1, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatIncompleteRectanglesAreNotCounted() {
         String[] inputGrid = new String[]{
@@ -116,7 +116,7 @@ public final class RectangleCounterTest {
         assertEquals(1, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatRectanglesOfDifferentSizesAreAllCounted() {
         String[] inputGrid = new String[]{
@@ -130,7 +130,7 @@ public final class RectangleCounterTest {
         assertEquals(3, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatIntersectionsWithoutCornerCharacterDoNotCountAsRectangleCorners() {
         String[] inputGrid = new String[]{
@@ -144,7 +144,7 @@ public final class RectangleCounterTest {
         assertEquals(2, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLargeInputWithManyRectangles() {
         String[] inputGrid = new String[]{

exercises/robot-name/src/test/java/RobotTest.java

@@ -22,13 +22,13 @@ public class RobotTest {
         assertIsValidName(robot.getName());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void differentRobotsHaveDifferentNames() {
         assertThat(robot.getName(), not(equalTo(new Robot().getName())));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void resetName() {
         final String name = robot.getName();

exercises/robot-simulator/src/test/java/RobotTest.java

@@ -13,7 +13,7 @@ public final class RobotTest {
         assertTrue(robot.getGridPosition().equals(initialGridPosition));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testRobotIsCreatedWithCorrectInitialOrientation() {
         final Orientation initialOrientation = Orientation.NORTH;
@@ -22,7 +22,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(initialOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTurningRightDoesNotChangePosition() {
         final GridPosition initialGridPosition = new GridPosition(0, 0);
@@ -33,7 +33,7 @@ public final class RobotTest {
         assertTrue(robot.getGridPosition().equals(initialGridPosition));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTurningRightCorrectlyChangesOrientationFromNorthToEast() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.NORTH);
@@ -45,7 +45,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(expectedOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTurningRightCorrectlyChangesOrientationFromEastToSouth() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.EAST);
@@ -57,7 +57,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(expectedOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTurningRightCorrectlyChangesOrientationFromSouthToWest() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.SOUTH);
@@ -69,7 +69,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(expectedOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTurningRightCorrectlyChangesOrientationFromWestToNorth() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.WEST);
@@ -81,7 +81,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(expectedOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTurningLeftDoesNotChangePosition() {
         final GridPosition initialGridPosition = new GridPosition(0, 0);
@@ -92,7 +92,7 @@ public final class RobotTest {
         assertTrue(robot.getGridPosition().equals(initialGridPosition));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTurningLeftCorrectlyChangesOrientationFromNorthToWest() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.NORTH);
@@ -104,7 +104,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(expectedOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTurningLeftCorrectlyChangesOrientationFromWestToSouth() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.WEST);
@@ -116,7 +116,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(expectedOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTurningLeftCorrectlyChangesOrientationFromSouthToEast() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.SOUTH);
@@ -128,7 +128,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(expectedOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTurningLeftCorrectlyChangesOrientationFromEastToNorth() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.EAST);
@@ -140,7 +140,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(expectedOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testAdvancingDoesNotChangeOrientation() {
         final Orientation initialOrientation = Orientation.NORTH;
@@ -151,7 +151,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(initialOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testAdvancingWhenFacingNorthIncreasesYCoordinateByOne() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.NORTH);
@@ -163,7 +163,7 @@ public final class RobotTest {
         assertTrue(robot.getGridPosition().equals(expectedGridPosition));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testAdvancingWhenFacingSouthDecreasesYCoordinateByOne() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.SOUTH);
@@ -175,7 +175,7 @@ public final class RobotTest {
         assertTrue(robot.getGridPosition().equals(expectedGridPosition));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testAdvancingWhenFacingEastIncreasesXCoordinateByOne() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.EAST);
@@ -187,7 +187,7 @@ public final class RobotTest {
         assertTrue(robot.getGridPosition().equals(expectedGridPosition));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testAdvancingWhenFacingWestDecreasesXCoordinateByOne() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.WEST);
@@ -199,7 +199,7 @@ public final class RobotTest {
         assertTrue(robot.getGridPosition().equals(expectedGridPosition));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInstructionsToMoveWestAndNorth() {
         final Robot robot = new Robot(new GridPosition(0, 0), Orientation.NORTH);
@@ -213,7 +213,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(expectedOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInstructionsToMoveWestAndSouth() {
         final Robot robot = new Robot(new GridPosition(2, -7), Orientation.EAST);
@@ -227,7 +227,7 @@ public final class RobotTest {
         assertTrue(robot.getOrientation().equals(expectedOrientation));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInstructionsToMoveEastAndNorth() {
         final Robot robot = new Robot(new GridPosition(8, 4), Orientation.SOUTH);

exercises/series/src/test/java/SeriesTest.java

@@ -26,7 +26,7 @@ public class SeriesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void hasDigitsLong() {
         Series sut = new Series("0123456789");
         List<Integer> expected = Arrays.asList(0, 1, 2, 3, 4, 5, 6, 7, 8, 9);
@@ -37,7 +37,7 @@ public class SeriesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void keepsTheDigitOrderIfReversed() {
         Series sut = new Series("9876543210");
         List<Integer> expected = Arrays.asList(9, 8, 7, 6, 5, 4, 3, 2, 1, 0);
@@ -48,7 +48,7 @@ public class SeriesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void keepsArbitraryDigitOrder() {
         Series sut = new Series("936923468");
         List<Integer> expected = Arrays.asList(9, 3, 6, 9, 2, 3, 4, 6, 8);
@@ -59,7 +59,7 @@ public class SeriesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void canSliceByOne() {
         Series sut = new Series("01234");
         List<List<Integer>> expected = Arrays.asList(
@@ -76,7 +76,7 @@ public class SeriesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void canSliceByTwo() {
         Series sut = new Series("98273463");
         List<List<Integer>> expected = Arrays.asList(
@@ -95,7 +95,7 @@ public class SeriesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void canSliceByThree() {
         Series sut = new Series("01234");
         List<List<Integer>> expected = Arrays.asList(
@@ -110,7 +110,7 @@ public class SeriesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void canSliceByThreeWithDuplicateDigits() {
         Series sut = new Series("31001");
         List<List<Integer>> expected = Arrays.asList(
@@ -125,7 +125,7 @@ public class SeriesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void canSliceByFour() {
         Series sut = new Series("91274");
         List<List<Integer>> expected = Arrays.asList(
@@ -139,7 +139,7 @@ public class SeriesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void canSliceByFive() {
         Series sut = new Series("81228");
         List<List<Integer>> expected = Arrays.asList(
@@ -152,7 +152,7 @@ public class SeriesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void throwsAnErrorIfNotEnoughDigitsToSlice() {
         thrown.expect(IllegalArgumentException.class);
         new Series("01032987583").slices(12);

exercises/sieve/src/test/java/SieveTest.java

@@ -18,7 +18,7 @@ public class SieveTest {
         assertEquals(expectedOutput, sieve.getPrimes());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void findPrimesUpTo10() {
         Sieve sieve = new Sieve(10);
@@ -27,7 +27,7 @@ public class SieveTest {
         assertEquals(expectedOutput, sieve.getPrimes());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void findPrimesUpTo1000() {
         Sieve sieve = new Sieve(1000);

exercises/simple-cipher/src/test/java/SimpleCipherStepOneTest.java

@@ -25,14 +25,14 @@ public class SimpleCipherStepOneTest {
         assertEquals(cipherText, cipherWithDefaultKey.encode("aaaaaaaaaa"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherCanDecode() {
         String cipherText = "aaaaaaaaaa";
         assertEquals(cipherText, cipherWithDefaultKey.decode(cipherWithDefaultKey.getKey().substring(0, 10)));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherIsReversible() {
         String plainText = "abcdefghij";

exercises/simple-cipher/src/test/java/SimpleCipherStepThreeTest.java

@@ -12,19 +12,19 @@ public class SimpleCipherStepThreeTest {
     @Rule
     public ExpectedException expectedException = ExpectedException.none();
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherKeyIsMadeOfLetters() {
         assertTrue(new Cipher().getKey().matches("[a-z]+"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void defaultCipherKeyIs100Characters() {
         assertEquals(100, new Cipher().getKey().length());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherKeysAreRandomlyGenerated() {
         String newKey = new Cipher().getKey();
@@ -33,28 +33,28 @@ public class SimpleCipherStepThreeTest {
                 "both returned key: " + newKey, newKey.equals(new Cipher().getKey()));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherThrowsWithAllCapsKey() {
         expectedException.expect(IllegalArgumentException.class);
         new Cipher("ABCDEF");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherThrowsWithAnyCapsKey() {
         expectedException.expect(IllegalArgumentException.class);
         new Cipher("abcdEFg");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherThrowsWithNumericKey() {
         expectedException.expect(IllegalArgumentException.class);
         new Cipher("12345");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherThrowsWithAnyNumericKey() {
         expectedException.expect(IllegalArgumentException.class);

exercises/simple-cipher/src/test/java/SimpleCipherStepTwoTest.java

@@ -21,62 +21,62 @@ public class SimpleCipherStepTwoTest {
         cipherWithSetKey = new Cipher(key);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherKeepsTheSubmittedKey() {
         assertEquals(key, cipherWithSetKey.getKey());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherThrowsWithEmptyKey() {
         expectedException.expect(IllegalArgumentException.class);
         new Cipher("");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherCanEncodeWithGivenKey() {
         String cipherText = "abcdefghij";
         assertEquals(cipherText, cipherWithSetKey.encode("aaaaaaaaaa"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherCanDecodeWithGivenKey() {
         String cipherText = "aaaaaaaaaa";
         assertEquals(cipherText, cipherWithSetKey.decode("abcdefghij"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherIsReversibleGivenKey() {
         String plainText = "abcdefghij";
         assertEquals(plainText, cipherWithSetKey.decode(cipherWithSetKey.encode("abcdefghij")));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherCanWrapEncode() {
         String cipherText = "zabcdefghi";
         assertEquals(cipherText, cipherWithSetKey.encode("zzzzzzzzzz"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherCanEncodeMessageThatIsShorterThanTheKey() {
         String cipherText = "abcde";
         assertEquals(cipherText, cipherWithSetKey.encode("aaaaa"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherCanDecodeMessageThatIsShorterThanTheKey() {
         String cipherText = "aaaaa";
         assertEquals(cipherText, cipherWithSetKey.decode("abcde"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cipherCanDoubleShiftEncode() {
         String plainText = "iamapandabear";

exercises/sublist/src/test/java/RelationshipComputerTest.java

@@ -18,7 +18,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.EQUAL, computedRelationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testEmptyListIsSublistOfNonEmptyList() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -28,7 +28,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.SUBLIST, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNonEmptyListIsSuperlistOfEmptyList() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -38,7 +38,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.SUPERLIST, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testListIsEqualToItself() {
         List<String> anyList = asList("1", "2", "3");
@@ -50,7 +50,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.EQUAL, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testDifferentListsOfTheSameLengthAreUnequal() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -60,7 +60,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.UNEQUAL, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSublistCheckDoesNotAbortAfterFalseStart() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -70,7 +70,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.SUBLIST, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSublistCheckHandlesExtraneousRepeatsOfFirstEntry() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -80,7 +80,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.SUBLIST, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSublistAtStart() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -90,7 +90,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.SUBLIST, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSublistInMiddle() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -100,7 +100,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.SUBLIST, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSublistAtEnd() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -110,7 +110,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.SUBLIST, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testAtStartOfSuperlist() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -120,7 +120,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.SUPERLIST, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInMiddleOfSuperlist() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -130,7 +130,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.SUPERLIST, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testAtEndOfSuperlist() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -140,7 +140,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.SUPERLIST, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testFirstListMissingElementFromSecondList() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -150,7 +150,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.UNEQUAL, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondListMissingElementFromFirstList() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -160,7 +160,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.UNEQUAL, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatListOrderingIsAccountedFor() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(
@@ -170,7 +170,7 @@ public class RelationshipComputerTest {
         assertEquals(Relationship.UNEQUAL, relationship);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatListsWithSameDigitsButDifferentNumbersAreUnequal() {
         Relationship relationship = new RelationshipComputer<>().computeRelationship(

exercises/sum-of-multiples/src/test/java/SumOfMultiplesTest.java

@@ -18,7 +18,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOf3and5UpToFour() {
 
         int[] set = {
@@ -31,7 +31,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOf3and5UpToTen() {
 
         int[] set = {
@@ -44,7 +44,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOf3and5UpToOneHundred() {
 
         int[] set = {
@@ -57,7 +57,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOf3and5UpToOneThousand() {
 
         int[] set = {
@@ -70,7 +70,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOf7and13and17UpToTwenty() {
 
         int[] set = {
@@ -84,7 +84,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOf4and6UpToFifteen() {
 
         int[] set = {
@@ -97,7 +97,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOf5and6and8UpToOneHundredFifty() {
 
         int[] set = {
@@ -111,7 +111,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOf5and25UpToTwoHundredSeventyFive() {
 
         int[] set = {
@@ -124,7 +124,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOf43and47UpToTenThousand() {
 
         int[] set = {
@@ -137,7 +137,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOfOneUpToOneHundred() {
 
         int[] set = {
@@ -149,7 +149,7 @@ public class SumOfMultiplesTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testSumOfMultiplesOfNoneUpToTenThousand() {
 
         int[] set = {};

exercises/triangle/src/test/java/TriangleTest.java

@@ -17,7 +17,7 @@ public class TriangleTest {
         assertEquals(TriangleKind.EQUILATERAL, triangle.getKind());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void largerEquilateralTrianglesAlsoHaveEqualSides() throws TriangleException {
         Triangle triangle = new Triangle(10, 10, 10);
@@ -25,7 +25,7 @@ public class TriangleTest {
         assertEquals(TriangleKind.EQUILATERAL, triangle.getKind());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void isoscelesTrianglesHaveLastTwoSidesEqual() throws TriangleException {
         Triangle triangle = new Triangle(3, 4, 4);
@@ -33,7 +33,7 @@ public class TriangleTest {
         assertEquals(TriangleKind.ISOSCELES, triangle.getKind());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void isoscelesTrianglesHaveFirstAndLastSidesEqual() throws TriangleException {
         Triangle triangle = new Triangle(4, 3, 4);
@@ -41,7 +41,7 @@ public class TriangleTest {
         assertEquals(TriangleKind.ISOSCELES, triangle.getKind());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void isoscelesTrianglesHaveTwoFirstSidesEqual() throws TriangleException {
         Triangle triangle = new Triangle(4, 4, 3);
@@ -49,7 +49,7 @@ public class TriangleTest {
         assertEquals(TriangleKind.ISOSCELES, triangle.getKind());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void isoscelesTrianglesHaveInFactExactlyTwoSidesEqual() throws TriangleException {
         Triangle triangle = new Triangle(10, 10, 2);
@@ -57,7 +57,7 @@ public class TriangleTest {
         assertEquals(TriangleKind.ISOSCELES, triangle.getKind());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void scaleneTrianglesHaveNoEqualSides() throws TriangleException {
         Triangle triangle = new Triangle(3, 4, 5);
@@ -65,7 +65,7 @@ public class TriangleTest {
         assertEquals(TriangleKind.SCALENE, triangle.getKind());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void scaleneTrianglesHaveNoEqualSidesAtLargerScaleEither() throws TriangleException {
         Triangle triangle = new Triangle(10, 11, 12);
@@ -73,7 +73,7 @@ public class TriangleTest {
         assertEquals(TriangleKind.SCALENE, triangle.getKind());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void scaleneTrianglesHaveNoEqualSidesInDescendingOrderEither() throws TriangleException {
         Triangle triangle = new Triangle(5, 4, 2);
@@ -81,7 +81,7 @@ public class TriangleTest {
         assertEquals(TriangleKind.SCALENE, triangle.getKind());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void verySmallTrianglesAreLegal() throws TriangleException {
         Triangle triangle = new Triangle(0.4, 0.6, 0.3);
@@ -89,35 +89,35 @@ public class TriangleTest {
         assertEquals(TriangleKind.SCALENE, triangle.getKind());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void trianglesWithNoSizeAreIllegal() throws TriangleException {
         thrown.expect(TriangleException.class);
         new Triangle(0, 0, 0);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void trianglesWithNegativeSidesAreIllegal() throws TriangleException {
         thrown.expect(TriangleException.class);
         new Triangle(3, 4, -5);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void trianglesViolatingTriangleInequalityAreIllegal() throws TriangleException {
         thrown.expect(TriangleException.class);
         new Triangle(1, 1, 3);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void trianglesViolatingTriangleInequalityAreIllegal2() throws TriangleException {
         thrown.expect(TriangleException.class);
         new Triangle(2, 4, 2);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void trianglesViolatingTriangleInequalityAreIllegal3() throws TriangleException {
         thrown.expect(TriangleException.class);

exercises/twelve-days/src/test/java/TwelveDaysTest.java

@@ -19,7 +19,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseOne, twelveDays.verse(1));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseTwo() {
         String expectedVerseTwo = "On the second day of Christmas my true love gave to me, two Turtle Doves, " +
@@ -27,7 +27,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseTwo, twelveDays.verse(2));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseThree() {
         String expectedVerseThree = "On the third day of Christmas my true love gave to me, three French Hens, " +
@@ -35,7 +35,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseThree, twelveDays.verse(3));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseFour() {
         String expectedVerseFour = "On the fourth day of Christmas my true love gave to me, four Calling Birds, " +
@@ -43,7 +43,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseFour, twelveDays.verse(4));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseFive() {
         String expectedVerseFive = "On the fifth day of Christmas my true love gave to me, five Gold Rings, " +
@@ -51,7 +51,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseFive, twelveDays.verse(5));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseSix() {
         String expectedVerseSix = "On the sixth day of Christmas my true love gave to me, six Geese-a-Laying, " +
@@ -60,7 +60,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseSix, twelveDays.verse(6));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseSeven() {
         String expectedVerseSeven = "On the seventh day of Christmas my true love gave to me, " +
@@ -69,7 +69,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseSeven, twelveDays.verse(7));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseEight() {
         String expectedVerseEight = "On the eighth day of Christmas my true love gave to me, eight Maids-a-Milking," +
@@ -78,7 +78,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseEight, twelveDays.verse(8));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseNine() {
         String expectedVerseNine = "On the ninth day of Christmas my true love gave to me, nine Ladies Dancing, " +
@@ -87,7 +87,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseNine, twelveDays.verse(9));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseTen() {
         String expectedVerseTen = "On the tenth day of Christmas my true love gave to me, ten Lords-a-Leaping, " +
@@ -97,7 +97,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseTen, twelveDays.verse(10));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseEleven() {
         String expectedVerseEleven = "On the eleventh day of Christmas my true love gave to me, " +
@@ -107,7 +107,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseEleven, twelveDays.verse(11));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testVerseTwelve() {
         String expectedVerseTwelve = "On the twelfth day of Christmas my true love gave to me, " +
@@ -117,7 +117,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseTwelve, twelveDays.verse(12));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testMultipleVerses() {
         String expectedVerseOneToThree = "On the first day of Christmas my true love gave to me, " +
@@ -129,7 +129,7 @@ public class TwelveDaysTest {
         assertEquals(expectedVerseOneToThree, twelveDays.verses(1, 3));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSingWholeSong() {
         String expectedSong = "On the first day of Christmas my true love gave to me, a Partridge in a Pear Tree.\n" +

exercises/word-count/src/test/java/WordCountTest.java

@@ -32,7 +32,7 @@ public class WordCountTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void countOneOfEach() {
         expectedWordCount.put("one", 1);
@@ -45,7 +45,7 @@ public class WordCountTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void countMultipleOccurences() {
         expectedWordCount.put("one", 1);
@@ -60,7 +60,7 @@ public class WordCountTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void ignorePunctuation() {
         expectedWordCount.put("car", 1);
@@ -76,7 +76,7 @@ public class WordCountTest {
 
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void includeNumbers() {
         expectedWordCount.put("testing", 2);
@@ -89,7 +89,7 @@ public class WordCountTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void normalizeCase() {
         expectedWordCount.put("go", 3);

exercises/wordy/src/test/java/WordProblemSolverTest.java

@@ -27,85 +27,85 @@ public final class WordProblemSolverTest {
         assertEquals(2, solver.solve("What is 1 plus 1?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSingleAddition2() {
         assertEquals(55, solver.solve("What is 53 plus 2?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSingleAdditionWithNegativeNumbers() {
         assertEquals(-11, solver.solve("What is -1 plus -10?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSingleAdditionOfLargeNumbers() {
         assertEquals(45801, solver.solve("What is 123 plus 45678?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSingleSubtraction() {
         assertEquals(16, solver.solve("What is 4 minus -12?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSingleMultiplication() {
         assertEquals(-75, solver.solve("What is -3 multiplied by 25?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSingleDivision() {
         assertEquals(-11, solver.solve("What is 33 divided by -3?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testMultipleAdditions() {
         assertEquals(3, solver.solve("What is 1 plus 1 plus 1?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testAdditionThenSubtraction() {
         assertEquals(8, solver.solve("What is 1 plus 5 minus -2?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testMultipleSubtractions() {
         assertEquals(3, solver.solve("What is 20 minus 4 minus 13?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSubtractionThenAddition() {
         assertEquals(14, solver.solve("What is 17 minus 6 plus 3?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testMultipleMultiplications() {
         assertEquals(-12, solver.solve("What is 2 multiplied by -2 multiplied by 3?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testAdditionThenMultiplication() {
         assertEquals(-8, solver.solve("What is -3 plus 7 multiplied by -2?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testMultipleDivisions() {
         assertEquals(2, solver.solve("What is -12 divided by 2 divided by -3?"));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testUnknownOperation() {
         expectedException.expect(IllegalArgumentException.class);
@@ -114,7 +114,7 @@ public final class WordProblemSolverTest {
         solver.solve("What is 52 cubed?");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInvalidQuestionFormat() {
         expectedException.expect(IllegalArgumentException.class);